Precursor miRBase

bta-mir-219-1 (MI0009781)

Accession MI0009781
Name bta-mir-219-1
similar to following miRCarta precursors bta-860-841.1
Organism Bos taurus
Genome UMD3.1
Location chr11:98,997,150-98,997,245 (-)
miRNA bta-miR-219-5p
miRNA bta-miR-219-3p
Sequence (5' -> 3')
(96 nts)
ACUCAGGAGCUUCGCCACUGAUUGUCCAAACGCAAUUCUUGUACGAGUCUGCGGCCAACCGAGAAUUGUGGCUGGACAUCUGUGGCUGAGCUCUGG
MFE -46.30 kcal/mol
first miRBase version 13.0
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
bta-mir-219-1
Family mir-219 (MIPF0000044)
Experiments
experiment Pubmed link
cloned 19267191 19758457
External DBs
Gene symbol MIR219-1
NCBI Gene 100313021

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Artzi et al. BMC Bioinformatics 2008 18215311 miRNAminer: a tool for homologous microRNA gene search.
2 Strozzi et al. Anim. Genet. 2009 18945293 Annotation of 390 bovine miRNA genes by sequence similarity with other species.
3 Jin et al. BMC Mol. Biol. 2009 19758457 Characterization of bovine miRNAs by sequencing and bioinformatics analysis.
4 Long et al. Biochem. Genet. 2009 19267191 Identification and characteristics of cattle microRNAs by homology searching and small RNA cloning.