| Accession | MI0009770 | ||||
| Name | bta-mir-199a-2 | ||||
| similar to following miRCarta precursors | bta-85-47.1 | ||||
| Organism | Bos taurus | ||||
| Genome | UMD3.1 | ||||
| Location |
chr7:16,508,926-16,508,996 (-) |
||||
| miRNA | bta-miR-199a-5p | ||||
| miRNA | bta-miR-199a-3p | ||||
| Sequence (5' -> 3') (71 nts) |
GCCAACCCAGUGUUCAGACUACCUGUUCAGGGGGCUCUGAAUGUGUACAGUAGUCUGCACAUUGGUUAGGC | ||||
| MFE | -29.80 kcal/mol | ||||
| first miRBase version | 13.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (2 precursors) |
bta-mir-3604-1
bta-mir-199a-2 |
||||
| Family | mir-199 (MIPF0000040) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Gu et al. | FEBS Lett. | 2007 | 17306260 | Identification and characterization of microRNAs from the bovine adipose tissue and mammary gland. |
| 2 | Coutinho et al. | Physiol. Genomics | 2007 | 17105755 | Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues. |
| 3 | Strozzi et al. | Anim. Genet. | 2009 | 18945293 | Annotation of 390 bovine miRNA genes by sequence similarity with other species. |