Precursor miRBase

bta-mir-188 (MI0009760)

Accession MI0009760
Name bta-mir-188
similar to following miRCarta precursors bta-397.1
Organism Bos taurus
Genome UMD3.1
Location chrX:92,886,827-92,886,912 (+)
miRNA bta-miR-188
Sequence (5' -> 3')
(86 nts)
UGCUCCCUCUCUCACAUCCCUUGCAUGGUGGAGGGUGAGCUUUCUGAAAACCCCUCCCACAUGCAGGGUUUGCAGGAUGGUGAGCC
MFE -38.40 kcal/mol
first miRBase version 13.0
last miRBase version 21.0
Clusters (10 kb)
(3 precursors)
bta-mir-532
bta-mir-188
bta-mir-502a-2
Family mir-188 (MIPF0000113)
Experiments
experiment Pubmed link
qRT-PCR 19170227
microarray 19170227
External DBs
Gene symbol MIR188
NCBI Gene 100313366

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Artzi et al. BMC Bioinformatics 2008 18215311 miRNAminer: a tool for homologous microRNA gene search.
2 Strozzi et al. Anim. Genet. 2009 18945293 Annotation of 390 bovine miRNA genes by sequence similarity with other species.
3 Tesfaye et al. Mol. Reprod. Dev. 2009 19170227 Identification and expression profiling of microRNAs during bovine oocyte maturation using heterologous approach.