| Accession | MI0009625 |
| Name | dwi-mir-133 |
| similar to following miRCarta precursors | dwi-26270.1 |
| Organism | Drosophila willistoni |
| Genome | dwil_r1.3_FB2010_02 |
| Location |
scf2_1100000004521:2,027,542-2,027,631 (+) |
| miRNA | dwi-miR-133 |
| Sequence (5' -> 3') (90 nts) |
UACAACACUGAAUGUAGCUGGUUGACAUCGGGUCAGAUCUAUUUAUUUGAAGCAUUUGGUCCCCUUCAACCAGCUGUAGCAGUGGUUGAU |
| MFE | -33.10 kcal/mol |
| first miRBase version | 12.0 |
| last miRBase version | 21.0 |
| Clusters (10 kb) (2 precursors) |
dwi-mir-133 dwi-mir-288 |
| Family | mir-133 (MIPF0000029) |
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Drosophila 12 Genomes Consortium et al. | Nature | 2007 | 17994087 | Evolution of genes and genomes on the Drosophila phylogeny. |