| Accession | MI0009315 |
| Name | dpe-mir-287 |
| similar to following miRCarta precursors | dpe-39817.1 |
| Organism | Drosophila persimilis |
| Genome | dper_r1.3_FB2010_02 |
| Location |
scaffold_8:2,069,966-2,070,040 (-) |
| miRNA | dpe-miR-287 |
| Sequence (5' -> 3') (75 nts) |
AUGUGUGAGUGUGGGGCCUGAAAUUUUGCACACAUUUACAAUAAUUGUAAAUGUGUUGAAAAUCGUUUGCACAAC |
| MFE | -20.10 kcal/mol |
| first miRBase version | 12.0 |
| last miRBase version | 21.0 |
| Clusters (10 kb) (2 precursors) |
dpe-mir-287 dpe-mir-124 |
| Family | mir-287 (MIPF0000224) |
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Drosophila 12 Genomes Consortium et al. | Nature | 2007 | 17994087 | Evolution of genes and genomes on the Drosophila phylogeny. |