| Accession | MI0008737 | ||||
| Name | ptr-mir-526a-1 | ||||
| similar to following miRCarta precursors | ptr-896.1 | ||||
| Organism | Pan troglodytes | ||||
| Genome | CHIMP2.1.4 | ||||
| Location |
19:58,614,407-58,614,490 (+) |
||||
| miRNA | ptr-miR-526a | ||||
| Sequence (5' -> 3') (84 nts) |
UCAGGCUGUGACCCUCUAGAGGGAAGCACUUUCUGUUGCUUGAAAGAAGAGAAAGCGCUUCCUUUUAGAGGAUUACUCUUUGAG | ||||
| MFE | -41.30 kcal/mol | ||||
| first miRBase version | 12.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (12 precursors) |
ptr-mir-525
ptr-mir-523 ptr-mir-518f ptr-mir-520b ptr-mir-518b ptr-mir-526a-1 ptr-mir-520c ptr-mir-518c ptr-mir-524 ptr-mir-517a ptr-mir-519d ptr-mir-521-2 |
||||
| Family | mir-515 (MIPF0000020) | ||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Baev et al. | Comput Biol Chem | 2009 | 18760970 | Computational identification of novel microRNA homologs in the chimpanzee genome. |