| Accession | MI0008733 | ||||
| Name | ptr-mir-522 | ||||
| similar to following miRCarta precursors | ptr-909.1 | ||||
| Organism | Pan troglodytes | ||||
| Genome | CHIMP2.1.4 | ||||
| Location |
19:58,660,239-58,660,324 (+) |
||||
| miRNA | ptr-miR-522 | ||||
| Sequence (5' -> 3') (86 nts) |
CUCAGGCUGUGUCCCUCUAGAGGGAAGCGCUUUCUGUUGUCUGAAAGAAAAGAAAAUGGUUCCCUUUAGAGUGUUACGCUUUGAGA | ||||
| MFE | -34.50 kcal/mol | ||||
| first miRBase version | 12.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (8 precursors) |
ptr-mir-520h
ptr-mir-521-1 ptr-mir-522 ptr-mir-519f ptr-mir-527 ptr-mir-516a-1 ptr-mir-1283b ptr-mir-516a-2 |
||||
| Family | mir-515 (MIPF0000020) | ||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Baev et al. | Comput Biol Chem | 2009 | 18760970 | Computational identification of novel microRNA homologs in the chimpanzee genome. |