Accession | MI0008710 | ||||
Name | ptr-mir-517b-1 | ||||
similar to following miRCarta precursors | ptr-933.1 | ||||
Organism | Pan troglodytes | ||||
Genome | CHIMP2.1.4 | ||||
Location |
19:58,628,806-58,628,872 (+) |
||||
miRNA | ptr-miR-517b | ||||
Sequence (5' -> 3') (67 nts) |
UGACCCUCUAGAUGGAAGCACUGUCUGUUGUCUUAAGAAAAGAUCGUGCAUCCCUUUAGAGUGUUAC | ||||
MFE | -24.40 kcal/mol | ||||
first miRBase version | 12.0 | ||||
last miRBase version | 21.0 | ||||
Clusters (10 kb) (9 precursors) |
ptr-mir-517a
ptr-mir-519d ptr-mir-521-2 ptr-mir-520d ptr-mir-517b-1 ptr-mir-520g ptr-mir-516b-2 ptr-mir-526a-2 ptr-mir-518e |
||||
Family | mir-515 (MIPF0000020) | ||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Baev et al. | Comput Biol Chem | 2009 | 18760970 | Computational identification of novel microRNA homologs in the chimpanzee genome. |