Accession | MI0008678 | ||||
Name | ptr-mir-454 | ||||
similar to following miRCarta precursors | ptr-272.1 | ||||
Organism | Pan troglodytes | ||||
Genome | CHIMP2.1.4 | ||||
Location |
17:57,850,866-57,850,979 (-) |
||||
miRNA | ptr-miR-454 | ||||
Sequence (5' -> 3') (114 nts) |
UCUGUUUAUCACCAGAUCCUAGAACCCUAUCAAUAUUGUCUCUGCUGUGUAAAUAGUUCUGAGUAGUGCAAUAUUGCUUAUAGGGUUUUGGUGUUUGGAAAGAACAAUGGGCAG | ||||
MFE | -39.60 kcal/mol | ||||
first miRBase version | 12.0 | ||||
last miRBase version | 21.0 | ||||
Clusters (10 kb) (1 precursors) |
ptr-mir-454 |
||||
Family | mir-454 (MIPF0000174) | ||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Baev et al. | Comput Biol Chem | 2009 | 18760970 | Computational identification of novel microRNA homologs in the chimpanzee genome. |