| Accession | MI0008668 | ||||
| Name | ptr-mir-433 | ||||
| similar to following miRCarta precursors | ptr-533.1 | ||||
| Organism | Pan troglodytes | ||||
| Genome | CHIMP2.1.4 | ||||
| Location |
14:100,573,198-100,573,289 (+) |
||||
| miRNA | ptr-miR-433 | ||||
| Sequence (5' -> 3') (92 nts) |
CGGGGAGAAGUACGGUGAGCCUGUCAUUAUUCAGAGAGGCUAGAUCCUCUGUGUUGAGAAGGAUCAUGAUGGGCUCCUCGGUGUUCUCCAGG | ||||
| MFE | -37.60 kcal/mol | ||||
| first miRBase version | 12.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (7 precursors) |
ptr-mir-337
ptr-mir-665 ptr-mir-431 ptr-mir-433 ptr-mir-127 ptr-mir-432 ptr-mir-136 |
||||
| Family | mir-433 (MIPF0000177) | ||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Baev et al. | Comput Biol Chem | 2009 | 18760970 | Computational identification of novel microRNA homologs in the chimpanzee genome. |