| Accession | MI0008664 | ||||
| Name | ptr-mir-424 | ||||
| similar to following miRCarta precursors | ptr-152.1 | ||||
| Organism | Pan troglodytes | ||||
| Genome | CHIMP2.1.4 | ||||
| Location |
X:135,218,516-135,218,612 (-) |
||||
| miRNA | ptr-miR-424 | ||||
| Sequence (5' -> 3') (97 nts) |
CGAGGGGAUACAGCAGCAAUUCAUGUUUUGAAGUGUUCUAAAUGGUUCAAAACGUGAGGCGCUGCUAUACCCCCUCGUGGGGAAGGUAGAAGGUGGG | ||||
| MFE | -41.80 kcal/mol | ||||
| first miRBase version | 12.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (5 precursors) |
ptr-mir-450b
ptr-mir-450a-1 ptr-mir-450a-2 ptr-mir-503 ptr-mir-424 |
||||
| Family | mir-322 (MIPF0000164) | ||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Baev et al. | Comput Biol Chem | 2009 | 18760970 | Computational identification of novel microRNA homologs in the chimpanzee genome. |