| Accession | MI0008456 | ||||
| Name | ptr-mir-1250 | ||||
| similar to following miRCarta precursors | ptr-1016.1 | ||||
| Organism | Pan troglodytes | ||||
| Genome | CHIMP2.1.4 | ||||
| Location |
17:80,590,916-80,591,027 (-) |
||||
| miRNA | ptr-miR-1250 | ||||
| Sequence (5' -> 3') (112 nts) |
CUGUCCCGCUGGCCUGGCAGGUGACGGUGCUGGAUGUGGCCUUUUUGCCUUUUCUAAAGGCCACAUUUUCCAGCCCAUUCAACCUUCCAGAGCCCUCUGAAGUGGCCACAGG | ||||
| MFE | -53.40 kcal/mol | ||||
| first miRBase version | 12.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (3 precursors) |
ptr-mir-657
ptr-mir-338 ptr-mir-1250 |
||||
| Family | mir-1250 (MIPF0000696) | ||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Baev et al. | Comput Biol Chem | 2009 | 18760970 | Computational identification of novel microRNA homologs in the chimpanzee genome. |