| Accession | MI0008406 | ||||
| Name | ptr-let-7g | ||||
| similar to following miRCarta precursors | ptr-58.1 | ||||
| potential naming conflicts with | ptr-let-7g (MIMAT0007942) | ||||
| Organism | Pan troglodytes | ||||
| Genome | CHIMP2.1.4 | ||||
| Location |
3:53,111,969-53,112,051 (-) |
||||
| miRNA | ptr-let-7g | ||||
| Sequence (5' -> 3') (83 nts) |
AGGCUGAGGUAGUAGUUUGUACAGUUUGAGGGUCUAUGAUACCACCCGGUACAGGAGAUAACUGUACAGGCCACUGCCUUGCC | ||||
| MFE | -38.00 kcal/mol | ||||
| first miRBase version | 12.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (1 precursors) |
ptr-let-7g |
||||
| Family | let-7 (MIPF0000002) | ||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Baev et al. | Comput Biol Chem | 2009 | 18760970 | Computational identification of novel microRNA homologs in the chimpanzee genome. |