Precursor miRBase

bmo-mir-133 (MI0008345)

Accession MI0008345
Name bmo-mir-133
similar to following miRCarta precursors bmo-30140.1
Organism Bombyx mori
Genome SILKDB2.0
Location nscaf2589:5,600,024-5,600,124 (-)
miRNA bmo-miR-133
Sequence (5' -> 3')
(101 nts)
AAAGCGAGAGCGUUGUUCGCUUUAGCUGGUUGACUUCGGGUCAAAUUGUCAUUUUCAUAUCAUUUGGUCCCCUUCAACCAGCUGUAGUUAACAUCUGCUUU
MFE -34.70 kcal/mol
first miRBase version 12.0
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
bmo-mir-133
Family mir-133 (MIPF0000029)
Experiments
experiment Pubmed link
Illumina 20199675

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 He et al. BMC Genomics 2008 18507836 Identification and characteristics of microRNAs from Bombyx mori.
2 Liu et al. BMC Genomics 2010 20199675 MicroRNAs of Bombyx mori identified by Solexa sequencing.