| Accession | MI0008333 | ||||||
| Name | hsa-mir-1912 | ||||||
| similar to following miRCarta precursors | hsa-1032.1 | ||||||
| Organism | Homo sapiens | ||||||
| Genome | GRCh38.p10 | ||||||
| Location |
chrX:114,651,544-114,651,623 (+) |
||||||
| miRNA | hsa-miR-1912 | ||||||
| Sequence (5' -> 3') (80 nts) |
CUCUAGGAUGUGCUCAUUGCAUGGGCUGUGUAUAGUAUUAUUCAAUACCCAGAGCAUGCAGUGUGAACAUAAUAGAGAUU | ||||||
| MFE | -29.90 kcal/mol | ||||||
| first miRBase version | 12.0 | ||||||
| last miRBase version | 21.0 | ||||||
| Clusters (10 kb) (2 precursors) |
hsa-mir-1912 hsa-mir-1264 |
||||||
| Family | mir-1912 (MIPF0000768) | ||||||
| Experiments |
|
||||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Bar et al. | Stem Cells | 2008 | 18583537 | MicroRNA discovery and profiling in human embryonic stem cells by deep sequencing of small RNA libraries. |
| 2 | Goff et al. | PLoS ONE | 2009 | 19784364 | Ago2 immunoprecipitation identifies predicted microRNAs in human embryonic stem cells and neural precursors. |