| Accession | MI0008212 | ||||||
| Name | ssc-mir-16-2 | ||||||
| similar to following miRCarta precursors | ssc-62.1 | ||||||
| potential naming conflicts with | ssc-mir-16-1 (MI0008213) | ||||||
| Organism | Sus scrofa | ||||||
| miRNA | ssc-miR-16 | ||||||
| Sequence (5' -> 3') (79 nts) |
CAGUGCCUUAGCAGCACGUAAAUAUUGGCGUUAAGAUUCUAAAAUUAUCUCCAGUAUUAACUGUGCUGCUGAAGUAAGG | ||||||
| MFE | -27.50 kcal/mol | ||||||
| first miRBase version | 12.0 | ||||||
| last miRBase version | 21.0 | ||||||
| Family | mir-15 (MIPF0000006) | ||||||
| Experiments |
|
||||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Kim et al. | Mamm. Genome | 2008 | 18548309 | Identification and characterization of new microRNAs from pig. |
| 2 | Cho et al. | Mol. Biol. Rep. | 2010 | 20180025 | Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue. |
| 3 | Nielsen et al. | Anim. Genet. | 2010 | 19917043 | MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing. |
| 4 | Li et al. | J. Cell. Biochem. | 2011 | 21312241 | MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing. |
| 5 | Chen et al. | BMC Genomics | 2014 | 24499489 | Exploration of microRNAs in porcine milk exosomes. |