Precursor miRBase

gga-mir-193a (MI0007564)

Accession MI0007564
Name gga-mir-193a
similar to following miRCarta precursors gga-26758-300.1
Organism Gallus gallus
miRNA gga-miR-193a-3p
miRNA gga-miR-193a-5p
Sequence (5' -> 3')
(77 nts)
AGCUGAGGGCUGGGUCUUUGCGGGCGAGAUGAGAGGUUCGUGUCUUCAACUGGCCUACAAAGUCCCAGUUCUCGGCU
MFE -45.60 kcal/mol
first miRBase version 12.0
last miRBase version 21.0
Family mir-193 (MIPF0000082)
Experiments
experiment Pubmed link
Illumina 23034410

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Glazov et al. Genome Res. 2008 18469162 A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach.
2 Shao et al. Gene 2008 18511220 Identification of novel chicken microRNAs and analysis of their genomic organization.
3 Meunier et al. Genome Res. 2013 23034410 Birth and expression evolution of mammalian microRNA genes.