Accession | MI0006385 | ||||
Name | hsa-mir-1250 | ||||
similar to following miRCarta precursors | hsa-1016-2285.1 | ||||
Organism | Homo sapiens | ||||
Genome | GRCh38.p10 | ||||
Location |
chr17:81,133,196-81,133,308 (-) |
||||
miRNA | hsa-miR-1250-5p | ||||
miRNA | hsa-miR-1250-3p | ||||
Sequence (5' -> 3') (113 nts) |
CUGUCCCGCUGGCCUGGCAGGUGACGGUGCUGGAUGUGGCCUUUUUGCCUUUUCUAAAGGCCACAUUUUCCAGCCCAUUCAACCUUCCAGAGCCCUCUGAAGUGGCCACAGGC | ||||
MFE | -53.40 kcal/mol | ||||
first miRBase version | 11.0 | ||||
last miRBase version | 21.0 | ||||
Clusters (10 kb) (4 precursors) |
hsa-mir-657
hsa-mir-3065 hsa-mir-338 hsa-mir-1250 |
||||
Family | mir-1250 (MIPF0000696) | ||||
Experiments |
|
||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Morin et al. | Genome Res. | 2008 | 18285502 | Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells. |
2 | Meunier et al. | Genome Res. | 2013 | 23034410 | Birth and expression evolution of mammalian microRNA genes. |