| Accession | MI0006273 | ||||
| Name | hsa-mir-1180 | ||||
| similar to following miRCarta precursors | hsa-1549-214.1 | ||||
| Organism | Homo sapiens | ||||
| Genome | GRCh38.p10 | ||||
| Location |
chr17:19,344,506-19,344,574 (-) |
||||
| miRNA | hsa-miR-1180-5p | ||||
| miRNA | hsa-miR-1180-3p | ||||
| Sequence (5' -> 3') (69 nts) |
GCUGCUGGACCCACCCGGCCGGGAAUAGUGCUCCUGGUUGUUUCCGGCUCGCGUGGGUGUGUCGGCGGC | ||||
| MFE | -39.00 kcal/mol | ||||
| first miRBase version | 11.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (1 precursors) |
hsa-mir-1180 |
||||
| Family | mir-1180 (MIPF0000789) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Subramanian et al. | Oncogene | 2008 | 17922033 | MicroRNA expression signature of human sarcomas. |
| 2 | Nygaard et al. | BMC Med Genomics | 2009 | 19508715 | Identification and analysis of miRNAs in human breast cancer and teratoma samples using deep sequencing. |
| 3 | Meunier et al. | Genome Res. | 2013 | 23034410 | Birth and expression evolution of mammalian microRNA genes. |