| Accession | MI0006167 | ||||
| Name | rno-mir-92b | ||||
| similar to following miRCarta precursors | rno-581-115.1 | ||||
| Organism | Rattus norvegicus | ||||
| Genome | Rnor_5.0 | ||||
| Location |
chr2:207,955,680-207,955,762 (-) |
||||
| miRNA | rno-miR-92b-5p | ||||
| miRNA | rno-miR-92b-3p | ||||
| Sequence (5' -> 3') (83 nts) |
GGUGGGCAGGAGGGACGGGACGCGGUGCAGUGUUGUUCUUUCCCCUGCCAAUAUUGCACUCGUCCCGGCCUCCGGCCCCCUCG | ||||
| MFE | -50.70 kcal/mol | ||||
| first miRBase version | 10.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (1 precursors) |
rno-mir-92b |
||||
| Family | mir-25 (MIPF0000013) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
| 2 | He et al. | Acta Biochim. Biophys. Sin. (Shanghai) | 2007 | 17805466 | Cloning and identification of novel microRNAs from rat hippocampus. |
| 3 | Linsen et al. | BMC Genomics | 2010 | 20403161 | Small RNA expression and strain specificity in the rat. |