| Accession | MI0005717 | ||||
| Name | hsa-mir-509-3 | ||||
| similar to following miRCarta precursors | hsa-873-470.1 | ||||
| Organism | Homo sapiens | ||||
| Genome | GRCh38.p10 | ||||
| Location |
chrX:147,259,652-147,259,726 (-) |
||||
| miRNA | hsa-miR-509-3-5p | ||||
| miRNA | hsa-miR-509-3p | ||||
| Sequence (5' -> 3') (75 nts) |
GUGGUACCCUACUGCAGACGUGGCAAUCAUGUAUAAUUAAAAAUGAUUGGUACGUCUGUGGGUAGAGUACUGCAU | ||||
| MFE | -37.80 kcal/mol | ||||
| first miRBase version | 10.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (4 precursors) |
hsa-mir-514b
hsa-mir-509-2 hsa-mir-509-3 hsa-mir-509-1 |
||||
| Family | mir-506 (MIPF0000130) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Bentwich et al. | Nat. Genet. | 2005 | 15965474 | Identification of hundreds of conserved and nonconserved human microRNAs. |
| 2 | Novotny et al. | Int. J. Androl. | 2007 | 17573847 | Analysis of gene expression in normal and neoplastic human testis: new roles of RNA. |
| 3 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |