Accession | MI0005530 | ||||
Name | hsa-mir-509-2 | ||||
similar to following miRCarta precursors | hsa-978-470.1 | ||||
Organism | Homo sapiens | ||||
Genome | GRCh38.p10 | ||||
Location |
chrX:147,258,760-147,258,850 (-) |
||||
miRNA | hsa-miR-509-5p | ||||
miRNA | hsa-miR-509-3p | ||||
Sequence (5' -> 3') (91 nts) |
CAUGCUGUGUGUGGUACCCUACUGCAGACAGUGGCAAUCAUGUAUAAUUAAAAAUGAUUGGUACGUCUGUGGGUAGAGUACUGCAUGACAC | ||||
MFE | -37.50 kcal/mol | ||||
first miRBase version | 10.0 | ||||
last miRBase version | 21.0 | ||||
Clusters (10 kb) (4 precursors) |
hsa-mir-514b
hsa-mir-509-2 hsa-mir-509-3 hsa-mir-509-1 |
||||
Family | mir-506 (MIPF0000130) | ||||
Experiments |
|
||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Bentwich et al. | Nat. Genet. | 2005 | 15965474 | Identification of hundreds of conserved and nonconserved human microRNAs. |
2 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
3 | Novotny et al. | Int. J. Androl. | 2007 | 17573847 | Analysis of gene expression in normal and neoplastic human testis: new roles of RNA. |