| Accession | MI0005477 | ||||||||
| Name | mmu-mir-883b | ||||||||
| similar to following miRCarta precursors | mmu-25670-25669.1 | ||||||||
| Organism | Mus musculus | ||||||||
| Genome | GRCm38.p5 | ||||||||
| Location |
chrX:66,789,890-66,789,967 (-) |
||||||||
| miRNA | mmu-miR-883b-5p | ||||||||
| miRNA | mmu-miR-883b-3p | ||||||||
| Sequence (5' -> 3') (78 nts) |
UGCAAUGCAUUACUGAGAAUGGGUAGCAGUCACUUUGUACUAUGAGUAACUGCAACAUCUCUCAGUAUUGUAAGGUUC | ||||||||
| MFE | -27.80 kcal/mol | ||||||||
| first miRBase version | 10.0 | ||||||||
| last miRBase version | 21.0 | ||||||||
| Clusters (10 kb) (6 precursors) |
mmu-mir-742
mmu-mir-883a mmu-mir-883b mmu-mir-471 mmu-mir-741 mmu-mir-463 |
||||||||
| Family | mir-883 (MIPF0000389) | ||||||||
| Experiments |
|
||||||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
| 2 | Calabrese et al. | Proc. Natl. Acad. Sci. U.S.A. | 2007 | 17989215 | RNA sequence analysis defines Dicer's role in mouse embryonic stem cells. |
| 3 | Chiang et al. | Genes Dev. | 2010 | 20413612 | Mammalian microRNAs: experimental evaluation of novel and previously annotated genes. |
| 4 | Ahn et al. | Mol. Hum. Reprod. | 2010 | 20215419 | MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing. |