Precursor miRBase

mdo-let-7f-2 (MI0005349)

Accession MI0005349
Name mdo-let-7f-2
Organism Monodelphis domestica
Genome monDom5
Location NW_001583589.1:35,394-35,473 (-)
miRNA mdo-let-7f-5p
miRNA mdo-let-7f-2-3p
Sequence (5' -> 3')
(80 nts)
GGGAUGAGGUAGUAGAUUGUAUAGUUUUAGGGUCACACCCGAUCUCGGAGAUAACUAUACAGUCUACUGUCUUUCCCACG
MFE -35.40 kcal/mol
first miRBase version 9.0
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
mdo-let-7f-2
Family let-7 (MIPF0000002)
Experiments
experiment Pubmed link
Illumina 23034410
External DBs
Gene symbol MIRLET7F-2
NCBI Gene 100315605

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Devor et al. J. Hered. 2008 17965199 In vitro and in silico annotation of conserved and nonconserved microRNAs in the genome of the marsupial Monodelphis domestica.
2 Meunier et al. Genome Res. 2013 23034410 Birth and expression evolution of mammalian microRNA genes.