Precursor miRBase

mdo-mir-132 (MI0005338)

Accession MI0005338
Name mdo-mir-132
similar to following miRCarta precursors mdo-414-138.1
Organism Monodelphis domestica
Genome monDom5
Location chr2:517,586,549-517,586,614 (-)
miRNA mdo-miR-132-5p
miRNA mdo-miR-132-3p
Sequence (5' -> 3')
(66 nts)
GGGCAACCGUGGCUUUCGAUUGUUACUGUGGGAACCAGGGGUAACAGUCUACAGCCAUGGUCGCCC
MFE -37.90 kcal/mol
first miRBase version 9.0
last miRBase version 21.0
Clusters (10 kb)
(2 precursors)
mdo-mir-132
mdo-mir-212
Family mir-132 (MIPF0000065)
Experiments
experiment Pubmed link
Illumina 23034410
External DBs
Gene symbol MIR132
NCBI Gene 100034275

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Devor et al. J. Hered. 2008 17965199 In vitro and in silico annotation of conserved and nonconserved microRNAs in the genome of the marsupial Monodelphis domestica.
2 Meunier et al. Genome Res. 2013 23034410 Birth and expression evolution of mammalian microRNA genes.