| Accession | MI0005336 | ||||||
| Name | mdo-mir-96 | ||||||
| similar to following miRCarta precursors | mdo-28420.1 | ||||||
| Organism | Monodelphis domestica | ||||||
| Genome | monDom5 | ||||||
| Location |
chr8:189,667,847-189,667,943 (-) |
||||||
| miRNA | mdo-miR-96 | ||||||
| Sequence (5' -> 3') (97 nts) |
GAUGUCUGCUUGGCCCGUUUUGGCACUAGCACAUUUUUGCUUCUGUCUCUCUGCUCUGAGCAAUCAUGUGUAGUGCCAAUAUGGGAAAAGCAAGAUG | ||||||
| MFE | -44.60 kcal/mol | ||||||
| first miRBase version | 9.0 | ||||||
| last miRBase version | 21.0 | ||||||
| Clusters (10 kb) (3 precursors) |
mdo-mir-182
mdo-mir-96 mdo-mir-183 |
||||||
| Family | mir-96 (MIPF0000072) | ||||||
| Experiments |
|
||||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Devor et al. | J. Hered. | 2008 | 17965199 | In vitro and in silico annotation of conserved and nonconserved microRNAs in the genome of the marsupial Monodelphis domestica. |