Precursor miRBase

mdo-let-7a-2 (MI0005330)

Accession MI0005330
Name mdo-let-7a-2
similar to following miRCarta precursors mdo-6-426.1
Organism Monodelphis domestica
Genome monDom5
Location chr4:226,185,493-226,185,565 (+)
miRNA mdo-let-7a-5p
miRNA mdo-let-7a-3p
Sequence (5' -> 3')
(73 nts)
AGGUUGAGGUAGUAGGUUGUAUAGUUUAGAAUUACAUCAAGGGAGAUAACUGUACAGCCUCCUAGCUUUCCUU
MFE -25.30 kcal/mol
first miRBase version 9.0
last miRBase version 21.0
Clusters (10 kb)
(2 precursors)
mdo-mir-100
mdo-let-7a-2
Family let-7 (MIPF0000002)
Experiments
experiment Pubmed link
Illumina 23034410
External DBs
Gene symbol MIRLET7A-2
NCBI Gene 100034267

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Devor et al. J. Hered. 2008 17965199 In vitro and in silico annotation of conserved and nonconserved microRNAs in the genome of the marsupial Monodelphis domestica.
2 Meunier et al. Genome Res. 2013 23034410 Birth and expression evolution of mammalian microRNA genes.