| Accession | MI0005317 | ||||
| Name | mdo-mir-206 | ||||
| similar to following miRCarta precursors | mdo-817.1 | ||||
| Organism | Monodelphis domestica | ||||
| Genome | monDom5 | ||||
| Location |
chr2:300,498,999-300,499,074 (+) |
||||
| miRNA | mdo-miR-206 | ||||
| Sequence (5' -> 3') (76 nts) |
GAGGCAACAUGCUUCUUUAUAUCCCCAUAUGAAUUAUGCUGCUAUGGAAUGUAAGGAAGUGUGUGGUUUCGGGAAG | ||||
| MFE | -26.50 kcal/mol | ||||
| first miRBase version | 9.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (1 precursors) |
mdo-mir-206 |
||||
| Family | mir-1 (MIPF0000038) | ||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Devor et al. | J. Hered. | 2008 | 17965199 | In vitro and in silico annotation of conserved and nonconserved microRNAs in the genome of the marsupial Monodelphis domestica. |