Precursor miRBase

bta-mir-342 (MI0005059)

Accession MI0005059
Name bta-mir-342
similar to following miRCarta precursors bta-27874.1
Organism Bos taurus
Genome UMD3.1
Location chr21:66,706,848-66,706,941 (+)
miRNA bta-miR-342
Sequence (5' -> 3')
(94 nts)
UGGAAGCGGGUGCGAGGCGAGGGGUGCUAUCUGUGGUUGAGGACACGGCAAAUGAAACUGUCUCACACAGAAAUCGCACCCAUCUCCUCGGCCC
MFE -39.80 kcal/mol
first miRBase version 8.2
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
bta-mir-342
Family mir-342 (MIPF0000190)
Experiments
experiment Pubmed link
cloned 17105755 17306260 19267191
External DBs
Gene symbol MIR342
NCBI Gene 791058

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Gu et al. FEBS Lett. 2007 17306260 Identification and characterization of microRNAs from the bovine adipose tissue and mammary gland.
2 Coutinho et al. Physiol. Genomics 2007 17105755 Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues.
3 Long et al. Biochem. Genet. 2009 19267191 Identification and characteristics of cattle microRNAs by homology searching and small RNA cloning.