| Accession | MI0005023 | ||||||
| Name | bta-mir-545 | ||||||
| similar to following miRCarta precursors | bta-28030-28029.1 | ||||||
| Organism | Bos taurus | ||||||
| Genome | UMD3.1 | ||||||
| Location |
chrX:81,951,373-81,951,478 (+) |
||||||
| miRNA | bta-miR-545-5p | ||||||
| miRNA | bta-miR-545-3p | ||||||
| Sequence (5' -> 3') (106 nts) |
CCCAGCCUGGCACAUUCGUAGGCCUCAGUAAAUGUUUAUUGGAUGAAUAAAUGAAUGGCUCAUCAACAAACAUUUAUUGUGUGCCUGCUAACGUGAUCUCCACAGG | ||||||
| MFE | -28.70 kcal/mol | ||||||
| first miRBase version | 8.2 | ||||||
| last miRBase version | 21.0 | ||||||
| Clusters (10 kb) (2 precursors) |
bta-mir-374a
bta-mir-545 |
||||||
| Family | mir-95 (MIPF0000098) | ||||||
| Experiments |
|
||||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Coutinho et al. | Physiol. Genomics | 2007 | 17105755 | Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues. |
| 2 | Tesfaye et al. | Mol. Reprod. Dev. | 2009 | 19170227 | Identification and expression profiling of microRNAs during bovine oocyte maturation using heterologous approach. |