| Accession | MI0005014 | ||||||
| Name | bta-mir-193a | ||||||
| similar to following miRCarta precursors | bta-27815-25095.1 | ||||||
| Organism | Bos taurus | ||||||
| Genome | UMD3.1 | ||||||
| Location |
chr19:18,824,221-18,824,301 (-) |
||||||
| miRNA | bta-miR-193a-5p | ||||||
| miRNA | bta-miR-193a-3p | ||||||
| Sequence (5' -> 3') (81 nts) |
UGGGAGCUGAGAGCUGGGUCUUUGCGGGCGAGAUGAAGGUGUCGGUUCAACUGGCCUACAAAGUCCCAGUCCUCGGCCCCC | ||||||
| MFE | -47.90 kcal/mol | ||||||
| first miRBase version | 8.2 | ||||||
| last miRBase version | 21.0 | ||||||
| Clusters (10 kb) (1 precursors) |
bta-mir-193a |
||||||
| Family | mir-193 (MIPF0000082) | ||||||
| Experiments |
|
||||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Coutinho et al. | Physiol. Genomics | 2007 | 17105755 | Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues. |
| 2 | Glazov et al. | PLoS ONE | 2009 | 19633723 | Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection. |