Precursor miRBase

bta-mir-140 (MI0005010)

Accession MI0005010
Name bta-mir-140
similar to following miRCarta precursors bta-24870.1
Organism Bos taurus
Genome UMD3.1
Location chr18:37,088,137-37,088,230 (+)
miRNA bta-miR-140
Sequence (5' -> 3')
(94 nts)
UCUCUCUGUGUCCUGCCAGUGGUUUUACCCUAUGGUAGGUUACGUCAUGCUGUUCUACCACAGGGUAGAACCACGGACAGGAUACCGGGGCACC
MFE -50.90 kcal/mol
first miRBase version 8.2
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
bta-mir-140
Family mir-140 (MIPF0000085)
Experiments
experiment Pubmed link
cloned 17105755 17306260
qRT-PCR 19170227
microarray 19170227
External DBs
Gene symbol MIR140
NCBI Gene 791009

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Gu et al. FEBS Lett. 2007 17306260 Identification and characterization of microRNAs from the bovine adipose tissue and mammary gland.
2 Coutinho et al. Physiol. Genomics 2007 17105755 Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues.
3 Tesfaye et al. Mol. Reprod. Dev. 2009 19170227 Identification and expression profiling of microRNAs during bovine oocyte maturation using heterologous approach.