| Accession | MI0004937 | ||||
| Name | xtr-mir-143 | ||||
| similar to following miRCarta precursors | xtr-25977.1 | ||||
| Organism | Xenopus tropicalis | ||||
| Genome | JGI 4.2 | ||||
| Location |
GL173083.1:665,585-665,667 (+) |
||||
| miRNA | xtr-miR-143 | ||||
| Sequence (5' -> 3') (83 nts) |
UGUCUCCCAGCCCAAGGUGCAGUGCUGCAUCUCUGGUCAGUUGUGAGUCUGAGAUGAAGCACUGUAGCUCGGGAAGGGGGAAU | ||||
| MFE | -46.50 kcal/mol | ||||
| first miRBase version | 8.1 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (2 precursors) |
xtr-mir-143 xtr-mir-145 |
||||
| Family | mir-143 (MIPF0000094) | ||||
| Experiments |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Tang et al. | Genome Res. | 2008 | 18032731 | Xenopus microRNA genes are predominantly located within introns and are differentially expressed in adult frog tissues via post-transcriptional regulation. |