| Accession | MI0004886 | ||||
| Name | xtr-let-7c | ||||
| similar to following miRCarta precursors | xtr-37.1 | ||||
| potential naming conflicts with | xtr-let-7c (MIMAT0003644) | ||||
| Organism | Xenopus tropicalis | ||||
| Genome | JGI 4.2 | ||||
| Location |
GL173111.1:669,407-669,500 (+) |
||||
| miRNA | xtr-let-7c | ||||
| Sequence (5' -> 3') (94 nts) |
UGUGUGCAUCCAGGUUGAGGUAGUAGGUUGUAUGGUUUAGAAUGACACCCUGGGAGUUAACUGUACAACCUUCUAGCUUUCCUUGGAGCUCACU | ||||
| MFE | -38.50 kcal/mol | ||||
| first miRBase version | 8.1 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (2 precursors) |
xtr-mir-99
xtr-let-7c |
||||
| Family | let-7 (MIPF0000002) | ||||
| Experiments |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Tang et al. | Genome Res. | 2008 | 18032731 | Xenopus microRNA genes are predominantly located within introns and are differentially expressed in adult frog tissues via post-transcriptional regulation. |