| Accession | MI0004824 | ||||
| Name | xtr-mir-122 | ||||
| similar to following miRCarta precursors | xtr-26911.1 | ||||
| Organism | Xenopus tropicalis | ||||
| Genome | JGI 4.2 | ||||
| Location |
GL172864.1:287,748-287,816 (+) |
||||
| miRNA | xtr-miR-122 | ||||
| Sequence (5' -> 3') (69 nts) |
GAGCUAUGGAGUGUGACAAUGGUGUUUGUGUCAGAGCUAUCAAACGCCAUUAUCACACUAAUGAGCUAC | ||||
| MFE | -29.60 kcal/mol | ||||
| first miRBase version | 8.1 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (1 precursors) |
xtr-mir-122 |
||||
| Family | mir-122 (MIPF0000095) | ||||
| Experiments |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Tang et al. | Genome Res. | 2008 | 18032731 | Xenopus microRNA genes are predominantly located within introns and are differentially expressed in adult frog tissues via post-transcriptional regulation. |