| Accession | MI0004761 | ||||
| Name | bta-mir-30b | ||||
| similar to following miRCarta precursors | bta-76-362.1 | ||||
| Organism | Bos taurus | ||||
| Genome | UMD3.1 | ||||
| Location |
chr14:8,084,721-8,084,808 (+) |
||||
| miRNA | bta-miR-30b-5p | ||||
| miRNA | bta-miR-30b-3p | ||||
| Sequence (5' -> 3') (88 nts) |
CCAAGUUUUCAGUUCAUGUAAACAUCCUACACUCAGCUGUAACACACGAGUCGGCUGGGAGGUGGAUGUUUACUUCAGCUGACUUGGA | ||||
| MFE | -38.90 kcal/mol | ||||
| first miRBase version | 8.1 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (2 precursors) |
bta-mir-30d
bta-mir-30b |
||||
| Family | mir-30 (MIPF0000005) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Gu et al. | FEBS Lett. | 2007 | 17306260 | Identification and characterization of microRNAs from the bovine adipose tissue and mammary gland. |
| 2 | Coutinho et al. | Physiol. Genomics | 2007 | 17105755 | Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues. |
| 3 | Glazov et al. | PLoS ONE | 2009 | 19633723 | Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection. |