| Accession | MI0004757 | ||||||
| Name | bta-mir-181a-2 | ||||||
| similar to following miRCarta precursors | bta-32.1 | ||||||
| Organism | Bos taurus | ||||||
| Genome | UMD3.1 | ||||||
| Location |
chr11:95,709,411-95,709,520 (+) |
||||||
| miRNA | bta-miR-181a | ||||||
| Sequence (5' -> 3') (110 nts) |
UGCCAGGGCCAGGACCCAGUCUUCAGAGGACUCCAAGGAACAUUCAACGCUGUCGGUGAGUUUGGGAUUUGAAAAAACCACCGACCGUUGACUGUACCUUGGGUUCCUUA | ||||||
| MFE | -46.10 kcal/mol | ||||||
| first miRBase version | 8.1 | ||||||
| last miRBase version | 21.0 | ||||||
| Clusters (10 kb) (2 precursors) |
bta-mir-181a-2 bta-mir-181b-2 |
||||||
| Family | mir-181 (MIPF0000007) | ||||||
| Experiments |
|
||||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Coutinho et al. | Physiol. Genomics | 2007 | 17105755 | Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues. |
| 2 | Muroya et al. | J. Anim. Sci. | 2013 | 23100578 | Profiling of differentially expressed microRNA and the bioinformatic target gene analyses in bovine fast- and slow-type muscles by massively parallel sequencing. |