| Accession | MI0004752 | ||||||||
| Name | bta-mir-125a | ||||||||
| similar to following miRCarta precursors | bta-63.1 | ||||||||
| Organism | Bos taurus | ||||||||
| Genome | UMD3.1 | ||||||||
| Location |
chr18:58,015,535-58,015,620 (+) |
||||||||
| miRNA | bta-miR-125a | ||||||||
| Sequence (5' -> 3') (86 nts) |
UGCCGGCCUCUGCGUCCCUGAGACCCUUUAACCUGUGAGGACGUCCAGGGUCACAGGUGAGGUUCUUGGGAGCCUGGCGUCCGGCC | ||||||||
| MFE | -38.40 kcal/mol | ||||||||
| first miRBase version | 8.1 | ||||||||
| last miRBase version | 21.0 | ||||||||
| Clusters (10 kb) (3 precursors) |
bta-mir-99b
bta-let-7e bta-mir-125a |
||||||||
| Family | mir-10 (MIPF0000033) | ||||||||
| Experiments |
|
||||||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Coutinho et al. | Physiol. Genomics | 2007 | 17105755 | Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues. |
| 2 | Gu et al. | FEBS Lett. | 2007 | 17306260 | Identification and characterization of microRNAs from the bovine adipose tissue and mammary gland. |
| 3 | Tesfaye et al. | Mol. Reprod. Dev. | 2009 | 19170227 | Identification and expression profiling of microRNAs during bovine oocyte maturation using heterologous approach. |