| Accession | MI0004739 | ||||
| Name | bta-mir-16b | ||||
| similar to following miRCarta precursors | bta-27462.1 | ||||
| Organism | Bos taurus | ||||
| Genome | UMD3.1 | ||||
| Location |
chr1:107,923,236-107,923,328 (-) |
||||
| miRNA | bta-miR-16b | ||||
| Sequence (5' -> 3') (93 nts) |
CAUACUUGUUCCGCUGUAGCAGCACGUAAAUAUUGGCGUAGUAAAAUAAAUAUUAAACACCAAUAUUAUUGUGCUGCUUUAGCGUGACAGGGA | ||||
| MFE | -38.20 kcal/mol | ||||
| first miRBase version | 8.1 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (2 precursors) |
bta-mir-16b bta-mir-15b |
||||
| Family | mir-15 (MIPF0000006) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Gu et al. | FEBS Lett. | 2007 | 17306260 | Identification and characterization of microRNAs from the bovine adipose tissue and mammary gland. |
| 2 | Coutinho et al. | Physiol. Genomics | 2007 | 17105755 | Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues. |
| 3 | Long et al. | Biochem. Genet. | 2009 | 19267191 | Identification and characteristics of cattle microRNAs by homology searching and small RNA cloning. |