| Accession | MI0004734 | ||||
| Name | bta-let-7f-2 | ||||
| similar to following miRCarta precursors | bta-19.1 | ||||
| potential naming conflicts with | bta-let-7f (MIMAT0003519) | ||||
| Organism | Bos taurus | ||||
| Genome | UMD3.1 | ||||
| Location |
chrX:96,383,532-96,383,614 (-) |
||||
| miRNA | bta-let-7f | ||||
| Sequence (5' -> 3') (83 nts) |
UGUGGGAUGAGGUAGUAGAUUGUAUAGUUUUAGGGUCAUACCCCAUCUUGGAGAUAACUAUACAGUCUACUGUCUUUCCCACG | ||||
| MFE | -39.00 kcal/mol | ||||
| first miRBase version | 8.1 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (2 precursors) |
bta-mir-98
bta-let-7f-2 |
||||
| Family | let-7 (MIPF0000002) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Coutinho et al. | Physiol. Genomics | 2007 | 17105755 | Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues. |
| 2 | Gu et al. | FEBS Lett. | 2007 | 17306260 | Identification and characterization of microRNAs from the bovine adipose tissue and mammary gland. |
| 3 | Long et al. | Biochem. Genet. | 2009 | 19267191 | Identification and characteristics of cattle microRNAs by homology searching and small RNA cloning. |