| Accession | MI0004203 | ||||||
| Name | mmu-mir-770 | ||||||
| similar to following miRCarta precursors | mmu-25185-25184.1 | ||||||
| Organism | Mus musculus | ||||||
| Genome | GRCm38.p5 | ||||||
| Location |
chr12:109,563,692-109,563,785 (+) |
||||||
| miRNA | mmu-miR-770-5p | ||||||
| miRNA | mmu-miR-770-3p | ||||||
| Sequence (5' -> 3') (94 nts) |
GCCACCUUCUGUGCCCCCAGCACCACGUGUCUGGGCCACGUGAGCAACGCCACGUGGGCCUGACGUGGAGCUGGGGCCGCAGGGGUCUGAUGGC | ||||||
| MFE | -57.90 kcal/mol | ||||||
| first miRBase version | 9.0 | ||||||
| last miRBase version | 21.0 | ||||||
| Clusters (10 kb) (2 precursors) |
mmu-mir-770 mmu-mir-673 |
||||||
| Family | mir-770 (MIPF0000355) | ||||||
| Experiments |
|
||||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Berezikov et al. | Genome Res. | 2006 | 16954537 | Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis. |
| 2 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
| 3 | Chiang et al. | Genes Dev. | 2010 | 20413612 | Mammalian microRNAs: experimental evaluation of novel and previously annotated genes. |
| 4 | Ahn et al. | Mol. Hum. Reprod. | 2010 | 20215419 | MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing. |