Precursor miRBase

mmu-mir-216b (MI0004126)

Accession MI0004126
Name mmu-mir-216b
similar to following miRCarta precursors mmu-25045-25044.1
Organism Mus musculus
Genome GRCm38.p5
Location chr11:28,746,191-28,746,276 (+)
miRNA mmu-miR-216b-5p
miRNA mmu-miR-216b-3p
Sequence (5' -> 3')
(86 nts)
UUGGCAGACUGGGAAAUCUCUGCAGGCAAAUGUGAUGUCACUGAAGAAACCACACACUUACCUGUAGAGAUUCUUCAGUCUGACAA
MFE -36.70 kcal/mol
first miRBase version 8.2
last miRBase version 21.0
Clusters (10 kb)
(2 precursors)
mmu-mir-216b
mmu-mir-216c
Family mir-216 (MIPF0000054)
Experiments
experiment Pubmed link
Illumina 20413612
External DBs
Gene symbol Mir216b
NCBI Gene 735308

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Mineno et al. Nucleic Acids Res. 2006 16582102 The expression profile of microRNAs in mouse embryos.
2 Landgraf et al. Cell 2007 17604727 A mammalian microRNA expression atlas based on small RNA library sequencing.
3 Chiang et al. Genes Dev. 2010 20413612 Mammalian microRNAs: experimental evaluation of novel and previously annotated genes.
4 Ahn et al. Mol. Hum. Reprod. 2010 20215419 MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing.