Accession | MI0004126 | ||||
Name | mmu-mir-216b | ||||
similar to following miRCarta precursors | mmu-25045-25044.1 | ||||
Organism | Mus musculus | ||||
Genome | GRCm38.p5 | ||||
Location |
chr11:28,746,191-28,746,276 (+) |
||||
miRNA | mmu-miR-216b-5p | ||||
miRNA | mmu-miR-216b-3p | ||||
Sequence (5' -> 3') (86 nts) |
UUGGCAGACUGGGAAAUCUCUGCAGGCAAAUGUGAUGUCACUGAAGAAACCACACACUUACCUGUAGAGAUUCUUCAGUCUGACAA | ||||
MFE | -36.70 kcal/mol | ||||
first miRBase version | 8.2 | ||||
last miRBase version | 21.0 | ||||
Clusters (10 kb) (2 precursors) |
mmu-mir-216b mmu-mir-216c |
||||
Family | mir-216 (MIPF0000054) | ||||
Experiments |
|
||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Mineno et al. | Nucleic Acids Res. | 2006 | 16582102 | The expression profile of microRNAs in mouse embryos. |
2 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
3 | Chiang et al. | Genes Dev. | 2010 | 20413612 | Mammalian microRNAs: experimental evaluation of novel and previously annotated genes. |
4 | Ahn et al. | Mol. Hum. Reprod. | 2010 | 20215419 | MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing. |