| Accession | MI0004123 | ||||||
| Name | mmu-mir-675 | ||||||
| similar to following miRCarta precursors | mmu-24799-24798.1 | ||||||
| Organism | Mus musculus | ||||||
| Genome | GRCm38.p5 | ||||||
| Location |
chr7:142,577,064-142,577,147 (-) |
||||||
| miRNA | mmu-miR-675-5p | ||||||
| miRNA | mmu-miR-675-3p | ||||||
| Sequence (5' -> 3') (84 nts) |
UGCGGCCCAGGGACUGGUGCGGAAAGGGCCCACAGUGGACUUGGUACACUGUAUGCCCUAACCGCUCAGUCCCUGGGUCUGGCA | ||||||
| MFE | -56.00 kcal/mol | ||||||
| first miRBase version | 8.2 | ||||||
| last miRBase version | 21.0 | ||||||
| Clusters (10 kb) (1 precursors) |
mmu-mir-675 |
||||||
| Family | mir-675 (MIPF0000365) | ||||||
| Experiments |
|
||||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Mineno et al. | Nucleic Acids Res. | 2006 | 16582102 | The expression profile of microRNAs in mouse embryos. |
| 2 | Ahn et al. | Mol. Hum. Reprod. | 2010 | 20215419 | MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing. |
| 3 | Chiang et al. | Genes Dev. | 2010 | 20413612 | Mammalian microRNAs: experimental evaluation of novel and previously annotated genes. |