| Accession | MI0003820 | ||||
| Name | hsa-mir-454 | ||||
| similar to following miRCarta precursors | hsa-519-272.1 | ||||
| Organism | Homo sapiens | ||||
| Genome | GRCh38.p10 | ||||
| Location |
chr17:59,137,758-59,137,872 (-) |
||||
| miRNA | hsa-miR-454-5p | ||||
| miRNA | hsa-miR-454-3p | ||||
| Sequence (5' -> 3') (115 nts) |
UCUGUUUAUCACCAGAUCCUAGAACCCUAUCAAUAUUGUCUCUGCUGUGUAAAUAGUUCUGAGUAGUGCAAUAUUGCUUAUAGGGUUUUGGUGUUUGGAAAGAACAAUGGGCAGG | ||||
| MFE | -41.00 kcal/mol | ||||
| first miRBase version | 9.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (1 precursors) |
hsa-mir-454 |
||||
| Family | mir-454 (MIPF0000174) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Berezikov et al. | Genome Res. | 2006 | 16954537 | Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis. |
| 2 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |