| Accession | MI0003666 | ||||
| Name | hsa-mir-651 | ||||
| similar to following miRCarta precursors | hsa-399-1950.1 | ||||
| Organism | Homo sapiens | ||||
| Genome | GRCh38.p10 | ||||
| Location |
chrX:8,126,965-8,127,061 (+) |
||||
| miRNA | hsa-miR-651-5p | ||||
| miRNA | hsa-miR-651-3p | ||||
| Sequence (5' -> 3') (97 nts) |
AAUCUAUCACUGCUUUUUAGGAUAAGCUUGACUUUUGUUCAAAUAAAAAUGCAAAAGGAAAGUGUAUCCUAAAAGGCAAUGACAGUUUAAUGUGUUU | ||||
| MFE | -34.00 kcal/mol | ||||
| first miRBase version | 8.1 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (1 precursors) |
hsa-mir-651 |
||||
| Family | mir-651 (MIPF0000478) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Cummins et al. | Proc. Natl. Acad. Sci. U.S.A. | 2006 | 16505370 | The colorectal microRNAome. |
| 2 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
| 3 | Meunier et al. | Genome Res. | 2013 | 23034410 | Birth and expression evolution of mammalian microRNA genes. |