Precursor miRBase

hsa-mir-584 (MI0003591)

Accession MI0003591
Name hsa-mir-584
similar to following miRCarta precursors hsa-167-792.1
Organism Homo sapiens
Genome GRCh38.p10
Location chr5:149,062,313-149,062,409 (-)
miRNA hsa-miR-584-5p
miRNA hsa-miR-584-3p
Sequence (5' -> 3')
(97 nts)
UAGGGUGACCAGCCAUUAUGGUUUGCCUGGGACUGAGGAAUUUGCUGGGAUAUGUCAGUUCCAGGCCAACCAGGCUGGUUGGUCUCCCUGAAGCAAC
MFE -55.30 kcal/mol
first miRBase version 8.1
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
hsa-mir-584
Family mir-584 (MIPF0000533)
External DBs
Gene symbol MIR584
NCBI Gene 693169

External tools

Links
HMDD

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Cummins et al. Proc. Natl. Acad. Sci. U.S.A. 2006 16505370 The colorectal microRNAome.
2 Lui et al. Cancer Res. 2007 17616659 Patterns of known and novel small RNAs in human cervical cancer.
3 Landgraf et al. Cell 2007 17604727 A mammalian microRNA expression atlas based on small RNA library sequencing.