Precursor miRBase

rno-mir-374 (MI0003552)

Accession MI0003552
Name rno-mir-374
similar to following miRCarta precursors rno-25718-29685.1
Organism Rattus norvegicus
Genome Rnor_5.0
Location chrX:75,245,612-75,245,679 (-)
miRNA rno-miR-374-5p
miRNA rno-miR-374-3p
Sequence (5' -> 3')
(68 nts)
CUCGGAUGGAUAUAAUACAACCUGCUAAGUGUUCUAGCACUUAGCACGUUGUAUUAUUAUUGUCCGAG
MFE -36.20 kcal/mol
first miRBase version 8.0
last miRBase version 21.0
Clusters (10 kb)
(2 precursors)
rno-mir-421
rno-mir-374
Family mir-374 (MIPF0000288)
Experiments
experiment Pubmed link
SOLiD 20403161
External DBs
Gene symbol Mir374b
NCBI Gene 100314088

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Sewer et al. BMC Bioinformatics 2005 16274478 Identification of clustered microRNAs using an ab initio prediction method.
2 Watanabe et al. Genes Dev. 2006 16766679 Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes.
3 Landgraf et al. Cell 2007 17604727 A mammalian microRNA expression atlas based on small RNA library sequencing.
4 Linsen et al. BMC Genomics 2010 20403161 Small RNA expression and strain specificity in the rat.