Accession | MI0003545 | ||||||
Name | rno-mir-376a | ||||||
similar to following miRCarta precursors | rno-25237-25236.1 | ||||||
Organism | Rattus norvegicus | ||||||
Genome | Rnor_5.0 | ||||||
Location |
chr6:143,035,962-143,036,043 (+) |
||||||
miRNA | rno-miR-376a-5p | ||||||
miRNA | rno-miR-376a-3p | ||||||
Sequence (5' -> 3') (82 nts) |
UGAUAUUUAAAAGGUAGAUUCUCCUUCUAUGAGUACAAUAUUAAUGACUAAUCGUAGAGGAAAAUCCACGUUUUCAGUAUCA | ||||||
MFE | -23.10 kcal/mol | ||||||
first miRBase version | 8.0 | ||||||
last miRBase version | 21.0 | ||||||
Clusters (10 kb) (18 precursors) |
rno-mir-494
rno-mir-679 rno-mir-1193 rno-mir-666 rno-mir-543 rno-mir-495 rno-mir-667 rno-mir-376c rno-mir-376b rno-mir-3595 rno-mir-376a rno-mir-300 rno-mir-381 rno-mir-487b rno-mir-3576 rno-mir-539 rno-mir-6331 rno-mir-544 |
||||||
Family | mir-368 (MIPF0000091) | ||||||
Experiments |
|
||||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Sewer et al. | BMC Bioinformatics | 2005 | 16274478 | Identification of clustered microRNAs using an ab initio prediction method. |
2 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
3 | Linsen et al. | BMC Genomics | 2010 | 20403161 | Small RNA expression and strain specificity in the rat. |