| Accession | MI0003538 | ||||||
| Name | mmu-mir-503 | ||||||
| similar to following miRCarta precursors | mmu-25654-25653.1 | ||||||
| Organism | Mus musculus | ||||||
| Genome | GRCm38.p5 | ||||||
| Location |
chrX:53,053,984-53,054,054 (-) |
||||||
| miRNA | mmu-miR-503-5p | ||||||
| miRNA | mmu-miR-503-3p | ||||||
| Sequence (5' -> 3') (71 nts) |
UGCCCUAGCAGCGGGAACAGUACUGCAGUGAGUGUUUGGUGCCCUGGAGUAUUGUUUCCACUGCCUGGGUA | ||||||
| MFE | -36.30 kcal/mol | ||||||
| first miRBase version | 8.0 | ||||||
| last miRBase version | 21.0 | ||||||
| Clusters (10 kb) (7 precursors) |
mmu-mir-450b
mmu-mir-450a-1 mmu-mir-450a-2 mmu-mir-542 mmu-mir-351 mmu-mir-503 mmu-mir-322 |
||||||
| Family | mir-503 (MIPF0000183) | ||||||
| Experiments |
|
||||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Sewer et al. | BMC Bioinformatics | 2005 | 16274478 | Identification of clustered microRNAs using an ab initio prediction method. |
| 2 | Takada et al. | Nucleic Acids Res. | 2006 | 16973894 | Mouse microRNA profiles determined with a new and sensitive cloning method. |
| 3 | Mineno et al. | Nucleic Acids Res. | 2006 | 16582102 | The expression profile of microRNAs in mouse embryos. |
| 4 | Watanabe et al. | Genes Dev. | 2006 | 16766679 | Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes. |
| 5 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
| 6 | Chiang et al. | Genes Dev. | 2010 | 20413612 | Mammalian microRNAs: experimental evaluation of novel and previously annotated genes. |
| 7 | Ahn et al. | Mol. Hum. Reprod. | 2010 | 20215419 | MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing. |