| Accession | MI0003527 | ||||
| Name | rno-mir-541 | ||||
| similar to following miRCarta precursors | rno-25252-29559.1 | ||||
| Organism | Rattus norvegicus | ||||
| Genome | Rnor_5.0 | ||||
| Location |
chr6:143,055,012-143,055,101 (+) |
||||
| miRNA | rno-miR-541-5p | ||||
| miRNA | rno-miR-541-3p | ||||
| Sequence (5' -> 3') (90 nts) |
GCCAAAAUCAGAGAAGGGAUUCUGAUGUUGGUCACACUCCAAGAAUUUUAAAAUGAGUGGCGAACACAGAAUCCAUACUCUGCUUAUGGC | ||||
| MFE | -35.90 kcal/mol | ||||
| first miRBase version | 8.0 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (16 precursors) |
rno-mir-3592
rno-mir-382 rno-mir-134 rno-mir-668 rno-mir-485 rno-mir-154 rno-mir-496 rno-mir-377 rno-mir-541 rno-mir-409b rno-mir-409a rno-mir-412 rno-mir-3578 rno-mir-369 rno-mir-410 rno-mir-3072 |
||||
| Family | mir-541 (MIPF0000213) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Sewer et al. | BMC Bioinformatics | 2005 | 16274478 | Identification of clustered microRNAs using an ab initio prediction method. |
| 2 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
| 3 | Linsen et al. | BMC Genomics | 2010 | 20403161 | Small RNA expression and strain specificity in the rat. |